Bioinformatics and the Semantic Web
In this blog post, I’m going to describe how an approach which unifies Content-Addressable Storage (via BioSeq and Bitcache), RDF and SPARQL technologies to develop a scalable, distributed system for storing and querying large quantities of massively-linked biological data.
I’m assuming that readers are familiar with the basic concepts of RDF; if you aren’t, it would help to read the “Overview” section of the Wikipedia article. Those familiar with graph theory will understand RDF as a framework for describing labelled, directed multi-graphs.
Also, note that RDF itself is just a model and is not to be confused with a serialization format, much in the same way that the general concept of ‘sound’ is distinct from the MP3 file format. A mimetype of RDF/XML
, for example, signifies that a file is the serialized form of an RDF graph represented as XML-encoded data. Some other (IMHO superior) RDF serialization formats include Notation 3 (commonly abbreviated to “N3”), Turtle and N-Triples.
The State of Play
But back to Bioinformatics. At the moment, several serialization formats are used for storing and sharing biological data, including (but by no means limited to):
- FASTA
- GenBank
- Swiss-Prot
- HTML (yup, screen-scraping!)
- XML
Some of these formats are very difficult to use, with parsers available only in a few languages, and most of them hard-coding the entire set of possible expressions about data into the format itself. Furthermore, inter-format conversion can often be lossy, and there is no clear way to store, retrieve and query the data in these files without developing complex schemata and swapping data into and out of SQL databases.
Enter RDF
RDF and SPARQL can solve almost all of these issues. 90% of the incidental complexity that bioinformaticians have to deal with vis-à-vis data interchange formats should not exist, plain and simple. The main benefit that RDF brings to the table is that ontologies (i.e. the set of all expressible relationships between resources) are theoretically universal: if the predicate <ncbi:organism>
is understood by every computer program in the universe to mean that “the (subject) biological sequence is found in the (object) organism”, then a huge hurdle of interoperability is overcome. Now various agents in the system can produce and consume data with a universally-understood meaning.
SPARQL
As if the universal semantics offered by RDF aren’t sufficient, it’s accompanied by a kick-ass query language. SPARQL is enough on its own to make you want to switch all your data to RDF. I don’t know of any other widely-implemented query language which allows you to issue queries like the following (all of these prefixes have been made up, by the way):
Find all the research papers published since 1989 which mention a specific protein (essentially a one-query lit review):
PREFIX bioseq: <http://bioseq.org/>
PREFIX ncbi: <http://www.ncbi.nlm.nih.gov/ontology#>
SELECT ?paper
WHERE {
# The specific sequence mentioned here has the paper as a citation.
bioseq:a2126...d8c33 ncbi:citation ?paper .
# The paper's publication year is stored as `?year`.
?paper ncbi:pubyear ?year .
# The result set is filtered by the ‘since 1989’ criterion.
FILTER (?year >= 1989)
}
Find all proteins mentioned in research papers in which both of the given diseases are mentioned too, and return the list of papers and proteins:
PREFIX diseases: <http://example.org/disease-ontology#>
PREFIX ncbi: <http://www.ncbi.nlm.nih.gov/ontology#>
SELECT ?paper ?protein
WHERE {
# The protein has the paper as a relevant citation.
?protein ncbi:citation ?paper .
# As do the diseases identified by ‘disease-id-1’ and ‘disease-id-1’.
diseases:disease-id-1 ncbi:citation ?paper .
diseases:disease-id-2 ncbi:citation ?paper .
}
SPARQL supports more than just a basic SELECT
form. ASK
queries return booleans indicating whether a solution for the query exists (so are perhaps more efficient in some cases), and CONSTRUCT
queries create whole new RDF graphs with data filtered, sorted and modified according to the query parameters (useful for exporting certain neighborhoods of a large triplestore). And you’d be surprised how efficient some of the SPARQL implementations are; it’s feasible to run complex queries on repositories with millions, even billions of triples.
Porting Existing Data to RDF
To show how porting your data to RDF can simplify its representation, I’ve chosen an example of a biological sequence to RDF-ize. This is how the genetic sequence of the first chromosome of Saccharomyces cerevisiae (brewer’s yeast) is represented in FASTA format (data taken from yeastgenome.org):
>ref|NC_001133| [org=Saccharomyces cerevisiae] [strain=S288C] [moltype=genomic] [chromosome=I]
CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACCCACACACACA
CATCCTAACACTACCCTAACACAGCCCTAATCTAACCCTGGCCAACCTGTCTCTCAACTT
...
AGTATTAGGGTGTGGTGTGTGGGTGTGGTGTGGGTGTGGGTGTGGGTGTGGGTGTGGGTG
TGGGTGTGGTGTGGTGTGTGGGTGTGGTGTGGGTGTGGTGTGTGTGGG
There are about 3,800 lines in the whole file, so I’ve snipped the dataset. The first line is the sequence header: the FASTA format specifies that this must begin with a right-angle bracket character (‘>’). The rest is an ad hoc format giving more information about the sequence. The lines which follow are the sequence itself; this is an unambiguous DNA sequence, and so it is only made up of the characters ‘A’, ‘C’, ‘G’ and ‘T’.
The problems we can immediately notice here are that:
Only a small amount of sequence metadata can be given on the one line provided by the FASTA format;
The metadata format, being ad hoc, limits the amount of computer-readable information.
Now we’ll see how an RDF representation of the sequence might look. The following example is written in the Turtle format. The prefixes used have mostly been made up, but the real document could feasibly be this simple:
@prefix alphabets: <http://www.ncbi.nlm.nih.gov/alphabets/> .
@prefix bioseq: <http://bioseq.org/> .
@prefix ncbi: <http://www.ncbi.nlm.nih.gov/ontology#> .
@prefix xsd: <http://www.w3.org/2001/XMLSchema#> .
<bioseq:a21268b77c91c67973efa8289cc42a62772d8c33>
<ncbi:alphabet> <alphabets:unambiguous/dna>;
<ncbi:chromosome> "1"^^<xsd:integer>;
<ncbi:organism> "Saccharomyces cerevisiae";
<ncbi:ref> "NC_001133";
<ncbi:strain> "S288C" .
The @prefix
notation is just a sprinkle of syntactic sugar for abbreviating common parts of URIs. In plain English, this collection of RDF triples expresses the following ‘meaning’:
We’re talking about the sequence identified by the URI
http://bioseq.org/a21268b77c91c67973efa8289cc42a62772d8c33
. This sequence:- Is expressed in the alphabet
http://www.ncbi.nlm.nih.gov/alphabets/unambiguous/dna
(i.e. unambiguous DNA); - Is the first chromosome of the organism in which it is found;
- Is found in the organism “Saccharomyces cerevisiae”;
- Has an NCBI reference identifier string of
NC_001133
; and - Belongs to the organism strain
S2288C
.
- Is expressed in the alphabet
A few things should be noted about this particular example:
- It is assumed that NCBI hosts a complete ontology for expressing information about biological sequences, such as
http://www.ncbi.nlm.nih.gov/ontology#organism
, and so on. - You should read my previous post about BioSeq for more information on
bioseq:
URIs; in short, these allow you to universally identify individual biological sequences.
So we can now insert this sort of RDF data into a local ‘triplestore’ (the RDF equivalent of a database) and run SPARQL queries on it. Assume we’ve loaded a sizeable dataset into our RDF store, and we now want to filter through the triples to find exactly what we want. Thankfully, SPARQL is incredibly expressive, and queries can go from extremely precise to extremely general. Say we want to look for all unambiguous DNA sequences:
PREFIX alphabets: <http://www.ncbi.nlm.nih.gov/alphabets/>
PREFIX bioseq: <http://bioseq.org/>
PREFIX ncbi: <http://www.ncbi.nlm.nih.gov/ontology#>
PREFIX xsd: <http://www.w3.org/2001/XMLSchema#>
SELECT ?sequence
WHERE {
?sequence ncbi:alphabet <alphabets:unambiguous/dna>
}
How about just DNA sequences, unambiguous or ambiguous? Assuming the same prefix bindings:
SELECT ?sequence
WHERE {
{
?sequence ncbi:alphabet <alphabets:unambiguous/dna>
} UNION {
?sequence ncbi:alphabet <alphabets:ambiguous/dna>
}
}
Or all DNA sequences on the 2nd chromosome of S. cerevisiae?
SELECT ?sequence
WHERE {
?sequence ncbi:chromosome "2"^^<xsd:integer> ;
ncbi:organism "Saccharomyces cerevisiae" .
{
?sequence ncbi:alphabet <alphabets:unambiguous/dna> .
} UNION {
?sequence ncbi:alphabet <alphabets:ambiguous/dna> .
}
}
And don’t forget you can also issue ASK
and CONSTRUCT
queries. If you want to know more about SPARQL, I’d sincerely recommend reading the official spec.
Wrap-Up
As you can see, the benefits brought to bioinformatics data by these technologies are manifold. Comprehensive RDF parsing and serialization libraries exist for most major languages, Bitcache and BioSeq bring efficient CAS to any programming language with a HTTP client library, and SPARQL opens up these vast stores of knowledge to expressive and dynamic querying.
The next steps in integration for the semweb and bioinformatics communities are:
Education: Writing and sharing more tutorials on using and implementing these technologies.
Adoption: As more bioinformaticians and related institutions consume and produce RDF, semweb technologies will reach a critical mass within the bioinformatics community.
Contribution: As the semweb concepts are ‘field-tested’ by bioinformaticians, hopefully a feedback loop will be set up between the two communities: bioinformaticians make recommendations and contributions back to the semweb speci writers, who themselves seek input from bioinformaticians on how new proposals might help or hinder their work.
I hope you enjoyed this blog post; please don’t refrain from commenting if you have anything to say about it.